49
DISCOVERY OF THE NOVEL AUXILIARY FACTOR FOR -LACTAM RESISTANCE BLRA
IN COMMUNITY-ACQUIRED METHICILLIN-RESISTANT STAPHYLOCOCCUS AUREUSVolumen 14 Número 1 - 2 023
ABSTRACT
DISCOVERY OF THE NOVEL AUXILIARY FACTOR FOR
Β-LACTAM RESISTANCE BLRA IN COMMUNITY-ACQUIRED
METHICILLIN-RESISTANT STAPHYLOCOCCUS AUREUS
(1) Carrera de Nutrición y Dietética. Escuela Superior Politécnica de Chimborazo, Riobamba, 060101, Ecuador.
* Correspondence to igor.astudillo@espoch.edu.ec
Igor Eduardo Astudillo Skliarova ¹ igor.astudillo@espoch.edu.ec
Methicillin-resistant Staphylococcus aureus (MRSA) is one of the most important human pathogens that cause
a variety of infections in community and hospital settings. This organism displays high levels of resistance to
β-lactam antibiotics and this principally occurs due to the production of β-lactamase and the penicillin binding
protein PBP2a encoded by mecA gene. Furthermore, additional mechanisms, such as auxiliary factors, significantly
contribute to β-lactam resistance. However, the function of most of these factors is still unknown.
Recently, in our laboratory, the novel auxiliary factor gene blrA was initially identified by transposon mutagenesis
in the community-acquired MRSA strain JE2. Next, the transposon mutation was transduced to the community-
acquired MRSA strain MW2, resulting in the formation of a transposon mutant for blrA (blrA::ermB), denoted
as MW2A. Initially, our results suggested that MW2A is more susceptible to oxacillin than the MW2 wild-type.
Then, we performed the Minimum Inhibitory Concentration (MIC) method for the β-lactam antibiotics: oxacillin,
cefoxitin, cephradine, ceftazidime, cefaclor and imipenem. MW2A exhibited a two-fold reduction for all tested
β-lactam antibiotics compared to the MRSA wild-type strain MW2. Additionally, no phenotypical changes were
observed after performing PBP2a latex agglutination test and phage spot assay. Finally, using DeepTMHMM we
show that BlrA is likely to act intracellularly, which is typical of auxiliary factors.
In this study, we show that BlrA is clearly involved in β-lactam resistance, but does not affect the expression of
the gene mecA or the structure of the wall teichoic acids. Furthermore, we propose that that BlrA acts as an
auxiliary factor and is activated in response to antimicrobial stress.
Key words: auxiliary factors, Staphylococcus aureus, antibiotic resistance, β-lactam antibiotic.
Facultad de
Salud Pública
Facultad de
Salud Pública
CSSNLa Ciencia al Servicio de la Salud y la Nutrición
REVISTA CIENTÍFICA DIGITAL
La Ciencia al Servicio de la Salud y la Nutrición
http://revistas.espoch.edu.ec/index.php/cssn
ISSN 1390-874X BY
ARTÍCULOS ORIGINALES
1. INTRODUCTION
S. aureus is both a commensal and a pathogenic
organism. This organism colonises the nasal nares
of nearly 30% of the human population (1). The
principal site of colonisation is the nose; however,
other studies suggest that other parts of the body
may be colonised as well (2). S. aureus causes
a variety of suppurative infections and toxin-
mediated infections (3). S. aureus has become
a real threat in the community, hospital settings
and livestock due to the fact that this organism
has acquired resistance to many antibiotics by
different mechanisms, including vancomycin as
in the case of vancomycin insensitive S. aureus or
vancomycin resistant S. aureus (4).
S. aureus as other gram-positive bacteria has a
very thick cell wall, which is mainly composed
of many layers of peptidoglycan (PG). PG is a
polymer that mainly consists of two alternating
sugars: N-acetylglucosamine (GlcNAc) and
N-acetylmuramic acid (MurNAc) residues,
which are linked via β-(1-4) glycosidic bonds
(5). A tetrapeptide side chain is attached to the
carboxyl group of the N-acetylmuramic acid
residue and is composed of four alternating D-
and L-amino acids: L-alanine, D-iso-glutamic acid,
L-lysin and D-alanine (5). The PG of S. aureus
contains a pentaglycine interbridge, which
crosslinks different tetrapeptides by connecting
the carboxyl group of the terminal D-alanine to
the amino group of L-lysine thus forming a mesh-
like interconnected network (6).
50Igor Eduardo Astudillo Skliarova
http://revistas.espoch.edu.ec/index.php/cssn
For long time to the present, the diseases caused
by S. aureus have been treated using β-lactam
antibiotics. The most important structure shared
by all the antibiotics that belong to this group
is the β-lactam ring, which is crucial for their
activity (7). β-lactam antibiotics have a similar
structure to the D-alanyl-D-alanine end of the
peptidoglycan (8). Therefore, β-lactam antibiotics
competitively inhibit the enzymes involved in the
process of transpeptidation, which involves the
tetrapeptide crosslink formation (8, 9).
Methicillin-resistant S. aureus (MRSA) are
strains of S. aureus that have developed intrinsic
resistance to β-lactam antibiotics such as
methicillin, oxacillin or nafcillin, cephalosporins
and carbapenems (10). Infections caused by
MRSA were first detected in healthcare facilities
(healthcare acquired/associated (HA) MRSA).
HA-MRSA is considered one of the major
nosocomial pathogens in healthcare settings (11).
Nevertheless, cases of MRSA in the community
(community acquired/associated (CA) MRSA)
and from livestock (livestock acquired/associated
(LA) MRSA) have been reported in the last
decades (12). Recently, it was found that some
CA-MRSA isolates are becoming more resistant
to several non β-lactam antibiotics as well such
as tetracycline, erythromycin or levofloxacin (13).
All MRSA strains possess two main resistance
determinants: blaZ and mecA (14, 15). The
product of the gene blaZ is a β-lactamase, which
provides resistance to penicillins only. The gene
mecA, in turn, encodes an extra PBP which has
low affinity to penicillins and is referred to as
penicillin binding protein 2a (PBP2a). This last
enzyme is able to perform the cross-linking of
the cell wall even in the presence of β-lactam
antibiotics and is the principal mechanism of
resistance to β-lactam antibiotics (16). The gene
mecA is localised in a specific mobile genetic
element known as staphylococcal chromosome
cassette (SCCmec), which is absent in methicillin-
susceptible Staphylococcus aureus (MSSA) (17).
Different studies using mutants produced
by transposon mutagenesis show that the
expression of PBP2a is necessary for the
resistance of MRSA to β-lactam antibiotics, but
not sufficient. Therefore, apart from mecA and
blaZ, many other genes involved in resistance
to β-lactam antibiotics have been identified and
named such as fem genes (factors essential for
methicillin resistance) and aux genes (auxiliary
genes). Both of these factors are not related
to mecA gene (18). Although the mechanisms
of resistance to β-lactam and other group of
antibiotics employed by S. aureus have been
studied for many years, there are still many
unclear mechanisms. The aim of the present
study is to identify phenotypic changes in CA-
MRSA S. aureus strain MW2 bearing a mutation
in the putative auxiliary gene blrA (NRS_1669),
encoding the protein BlrA (WP_000080029).
2. METHODOLOGY
Bacterial strains and growth conditions
All bacterial strains and phages used in this
study are listed in Table 1. Bacterial strains
were cultivated on Columbia Blood Agar (CBA)
and Tryptic Soya Broth (TSB) (Thermo Fisher
Scientific) at 37°C. For the cultivation of the
MW2A mutant and the complemented mutant
S. aureus c-MW2A media were supplemented
with erythromycin and chloramphenicol,
respectively.
S. aureus genomic and plasmid DNA isolation
The genomic DNA was extracted from S. aureus
with the aid of a FastPrep®-24 instrument (MP
Biomedicals, Santa Ana, CA, USA), using the
default settings. The concentration of the isolated
DNA was measured using the Nanodrop machine
(Thermo Fisher Scientific, USA).
The plasmid was extracted from the E. coli
DC10B using the miniprep plasmid purification
kit (Qiagen) according to manufacturer's
instructions.
DNA amplification
The primers used for DNA amplification were
designed based on the sequence data of the
Nebraska transposon mutant in order to detect
Table 1: List of bacterial strains and phages used in this
study.
Bacterial strain or phage Genotype Source
S. aureus strain JE2 Wild type (19)
JE2A blrA::ermB (19)
S. aureus strain MW2 Wild type This study
MW2A blrA::ermB This study
Podophage φ68 - This study
http://revistas.espoch.edu.ec/index.php/cssn
For long time to the present, the diseases caused
by S. aureus have been treated using β-lactam
antibiotics. The most important structure shared
by all the antibiotics that belong to this group
is the β-lactam ring, which is crucial for their
activity (7). β-lactam antibiotics have a similar
structure to the D-alanyl-D-alanine end of the
peptidoglycan (8). Therefore, β-lactam antibiotics
competitively inhibit the enzymes involved in the
process of transpeptidation, which involves the
tetrapeptide crosslink formation (8, 9).
Methicillin-resistant S. aureus (MRSA) are
strains of S. aureus that have developed intrinsic
resistance to β-lactam antibiotics such as
methicillin, oxacillin or nafcillin, cephalosporins
and carbapenems (10). Infections caused by
MRSA were first detected in healthcare facilities
(healthcare acquired/associated (HA) MRSA).
HA-MRSA is considered one of the major
nosocomial pathogens in healthcare settings (11).
Nevertheless, cases of MRSA in the community
(community acquired/associated (CA) MRSA)
and from livestock (livestock acquired/associated
(LA) MRSA) have been reported in the last
decades (12). Recently, it was found that some
CA-MRSA isolates are becoming more resistant
to several non β-lactam antibiotics as well such
as tetracycline, erythromycin or levofloxacin (13).
All MRSA strains possess two main resistance
determinants: blaZ and mecA (14, 15). The
product of the gene blaZ is a β-lactamase, which
provides resistance to penicillins only. The gene
mecA, in turn, encodes an extra PBP which has
low affinity to penicillins and is referred to as
penicillin binding protein 2a (PBP2a). This last
enzyme is able to perform the cross-linking of
the cell wall even in the presence of β-lactam
antibiotics and is the principal mechanism of
resistance to β-lactam antibiotics (16). The gene
mecA is localised in a specific mobile genetic
element known as staphylococcal chromosome
cassette (SCCmec), which is absent in methicillin-
susceptible Staphylococcus aureus (MSSA) (17).
Different studies using mutants produced
by transposon mutagenesis show that the
expression of PBP2a is necessary for the
resistance of MRSA to β-lactam antibiotics, but
not sufficient. Therefore, apart from mecA and
blaZ, many other genes involved in resistance
to β-lactam antibiotics have been identified and
named such as fem genes (factors essential for
methicillin resistance) and aux genes (auxiliary
genes). Both of these factors are not related
to mecA gene (18). Although the mechanisms
of resistance to β-lactam and other group of
antibiotics employed by S. aureus have been
studied for many years, there are still many
unclear mechanisms. The aim of the present
study is to identify phenotypic changes in CA-
MRSA S. aureus strain MW2 bearing a mutation
in the putative auxiliary gene blrA (NRS_1669),
encoding the protein BlrA (WP_000080029).
2. METHODOLOGY
Bacterial strains and growth conditions
All bacterial strains and phages used in this
study are listed in Table 1. Bacterial strains
were cultivated on Columbia Blood Agar (CBA)
and Tryptic Soya Broth (TSB) (Thermo Fisher
Scientific) at 37°C. For the cultivation of the
MW2A mutant and the complemented mutant
S. aureus c-MW2A media were supplemented
with erythromycin and chloramphenicol,
respectively.
S. aureus genomic and plasmid DNA isolation
The genomic DNA was extracted from S. aureus
with the aid of a FastPrep®-24 instrument (MP
Biomedicals, Santa Ana, CA, USA), using the
default settings. The concentration of the isolated
DNA was measured using the Nanodrop machine
(Thermo Fisher Scientific, USA).
The plasmid was extracted from the E. coli
DC10B using the miniprep plasmid purification
kit (Qiagen) according to manufacturer's
instructions.
DNA amplification
The primers used for DNA amplification were
designed based on the sequence data of the
Nebraska transposon mutant in order to detect
Table 1: List of bacterial strains and phages used in this
study.
Bacterial strain or phage Genotype Source
S. aureus strain JE2 Wild type (19)
JE2A blrA::ermB (19)
S. aureus strain MW2 Wild type This study
MW2A blrA::ermB This study
Podophage φ68 - This study
51
DISCOVERY OF THE NOVEL AUXILIARY FACTOR FOR -LACTAM RESISTANCE BLRA
IN COMMUNITY-ACQUIRED METHICILLIN-RESISTANT STAPHYLOCOCCUS AUREUSVolumen 14 Número 1 - 2 023
The amplification of fragments was performed in
25 μL volumes with Premix Taq™ DNA Polymerase
(Bioline, Australia), 1 μL of each 20 μM primer
set (forward and reverse) and 100 ng of genomic
DNA. Each fragment was afterwards amplified
in a thermocycler (Gene Amp PCR System
9700) using conventional Hot Start PCR. For the
detection of ermB the following conditions were
applied: 95°C for 1 min, 25-35 cycles of 95°C for
15 seconds, 55°C for 15 seconds, and 72°C for 1
min, with a final extension at 72°C for 10 min.
For the detection of the blrA mutant allele, the
following conditions were applied: 95°C for 1
min, 25-35 cycles of 95°C for 15 s, 55°C for 15 s,
and 72°C for 50 s, with a final extension at 72°C
for 10 min. The DNA fragments were visualised
with the aid of agarose gel electrophoresis. The
band size was verified using the 1 Kb plus DNA
Ladder Thermo Scientific™.
BSAC Standardised Disc Diffusion Method
The bacterial suspension was adjusted in
order to achieve a turbidity equivalent to a 0.5
McFarland standard. After this, the suspension
was spread evenly using sterile swab over
the entire surface of commercially prepared
Mueller Hinton agar plates. Afterwards, within
15 min, with the aid of a disc dispenser (Oxoid,
Basingstoke, Hampshire, UK), the antibiotic discs
were firmly applied to the surface of the plate.
The required content of the antibiotic discs was
determined according to BSAC guidelines. The
plates were incubated at 37°C overnight and the
zone of inhibition around the disc was observed
the following day.
Minimum inhibitory concentration (MIC)
determination by broth microdilution method
Antibiotic stock solutions were prepared from
antibiotic powders to obtain a concentration
Table 2: List of primers used in this study
the erythromycin resistance gene marker ermB
of the transposon, located within the blrA mutant
allele. For this purpose, we used the primers
listed on Table 2.
Primer Sequence
blrA-J2-705up 5' TTGTTCTTTAGGTCTTTCCA 3'
blrA-J2-705dn 5' ATGTCGCAAAAAGTGTTGGT 3'
of 10 mg/L. All the antibiotics were sterilised
with the aid of 0.22-μm membrane filters. All
β-lactam antibiotics were two-fold serially
diluted starting from a concentration of 512
mg/L. Finally, 0.1 mL of each antibiotic dilution
was transferred to wells of a 96-well microplate.
The bacterial suspension was adjusted to an
optical density of 0.1 at 578 nm (OD578). Then,
5 μL of the bacterial suspension was added
to each well of the 96-well microplate. The
microplate was incubated overnight. Minimum
inhibitory concentration (MIC) is defined as the
lowest antibiotic concentration that completely
inhibits the growth of the studied organism
[4]. Therefore, the MIC was established by
comparing the wells containing the tested
organism with the negative (no growth) and
positive controls (growth). The well with no
visible growth (cloudy solution or a dot at the
bottom) was defined as the MIC.
Penicillin-binding protein (PBP2a) latex
agglutination test
This agglutination test was performed using
the Oxoid™ PBP2' Latex Agglutination Test Kit
and following manufacturer's instructions.
Agglutination is observed with the test
organisms if they produce PBP2a, but not with
test organisms that lack PBP2a or the Control
Latex within three minutes.
Phage spot assay
A single colony of the studied organism was
taken from the stock plates and suspended in TSB
containing erythromycin, chloramphenicol or no
antibiotic depending on the organism. The broth
was then incubated overnight using a shaking
incubator at 37°C and 200 rpm. On the following
day, the broth suspension of the organism was
diluted and adjusted to an optical density of 0.1
at 578 nm (OD578) using a spectrophotometer
(Thermo ScientificTM GENESYS 10S UV-Vis)
to measure the OD. Then, 100 μL from the
suspension were taken and thoroughly mixed
with 5 mL of pre-warmed soft agar. Then, the
pre-warmed soft agar containing the suspension
was poured onto CBA plates. Once the soft agar
had set, 5 -10 μL of a suspension containing the
podophage φ68 were applied to the overlay and
the plates were aerobically incubated at 37°C
for 24 hours.
DISCOVERY OF THE NOVEL AUXILIARY FACTOR FOR -LACTAM RESISTANCE BLRA
IN COMMUNITY-ACQUIRED METHICILLIN-RESISTANT STAPHYLOCOCCUS AUREUSVolumen 14 Número 1 - 2 023
The amplification of fragments was performed in
25 μL volumes with Premix Taq™ DNA Polymerase
(Bioline, Australia), 1 μL of each 20 μM primer
set (forward and reverse) and 100 ng of genomic
DNA. Each fragment was afterwards amplified
in a thermocycler (Gene Amp PCR System
9700) using conventional Hot Start PCR. For the
detection of ermB the following conditions were
applied: 95°C for 1 min, 25-35 cycles of 95°C for
15 seconds, 55°C for 15 seconds, and 72°C for 1
min, with a final extension at 72°C for 10 min.
For the detection of the blrA mutant allele, the
following conditions were applied: 95°C for 1
min, 25-35 cycles of 95°C for 15 s, 55°C for 15 s,
and 72°C for 50 s, with a final extension at 72°C
for 10 min. The DNA fragments were visualised
with the aid of agarose gel electrophoresis. The
band size was verified using the 1 Kb plus DNA
Ladder Thermo Scientific™.
BSAC Standardised Disc Diffusion Method
The bacterial suspension was adjusted in
order to achieve a turbidity equivalent to a 0.5
McFarland standard. After this, the suspension
was spread evenly using sterile swab over
the entire surface of commercially prepared
Mueller Hinton agar plates. Afterwards, within
15 min, with the aid of a disc dispenser (Oxoid,
Basingstoke, Hampshire, UK), the antibiotic discs
were firmly applied to the surface of the plate.
The required content of the antibiotic discs was
determined according to BSAC guidelines. The
plates were incubated at 37°C overnight and the
zone of inhibition around the disc was observed
the following day.
Minimum inhibitory concentration (MIC)
determination by broth microdilution method
Antibiotic stock solutions were prepared from
antibiotic powders to obtain a concentration
Table 2: List of primers used in this study
the erythromycin resistance gene marker ermB
of the transposon, located within the blrA mutant
allele. For this purpose, we used the primers
listed on Table 2.
Primer Sequence
blrA-J2-705up 5' TTGTTCTTTAGGTCTTTCCA 3'
blrA-J2-705dn 5' ATGTCGCAAAAAGTGTTGGT 3'
of 10 mg/L. All the antibiotics were sterilised
with the aid of 0.22-μm membrane filters. All
β-lactam antibiotics were two-fold serially
diluted starting from a concentration of 512
mg/L. Finally, 0.1 mL of each antibiotic dilution
was transferred to wells of a 96-well microplate.
The bacterial suspension was adjusted to an
optical density of 0.1 at 578 nm (OD578). Then,
5 μL of the bacterial suspension was added
to each well of the 96-well microplate. The
microplate was incubated overnight. Minimum
inhibitory concentration (MIC) is defined as the
lowest antibiotic concentration that completely
inhibits the growth of the studied organism
[4]. Therefore, the MIC was established by
comparing the wells containing the tested
organism with the negative (no growth) and
positive controls (growth). The well with no
visible growth (cloudy solution or a dot at the
bottom) was defined as the MIC.
Penicillin-binding protein (PBP2a) latex
agglutination test
This agglutination test was performed using
the Oxoid™ PBP2' Latex Agglutination Test Kit
and following manufacturer's instructions.
Agglutination is observed with the test
organisms if they produce PBP2a, but not with
test organisms that lack PBP2a or the Control
Latex within three minutes.
Phage spot assay
A single colony of the studied organism was
taken from the stock plates and suspended in TSB
containing erythromycin, chloramphenicol or no
antibiotic depending on the organism. The broth
was then incubated overnight using a shaking
incubator at 37°C and 200 rpm. On the following
day, the broth suspension of the organism was
diluted and adjusted to an optical density of 0.1
at 578 nm (OD578) using a spectrophotometer
(Thermo ScientificTM GENESYS 10S UV-Vis)
to measure the OD. Then, 100 μL from the
suspension were taken and thoroughly mixed
with 5 mL of pre-warmed soft agar. Then, the
pre-warmed soft agar containing the suspension
was poured onto CBA plates. Once the soft agar
had set, 5 -10 μL of a suspension containing the
podophage φ68 were applied to the overlay and
the plates were aerobically incubated at 37°C
for 24 hours.
52Igor Eduardo Astudillo Skliarova
http://revistas.espoch.edu.ec/index.php/cssn
3. RESULTS
Previously, in our laboratory, the function of genes
required for β-lactam resistance was studied with
the aid of transposon mutagenesis, whereby a
transposon mutant library was constructed based
on S. aureus strain JE2 and mutants with reduced
oxacillin resistance were isolated from this library
(unpublished data). The transposon used for the
generation of the mutant library contains an
erythromycin resistance (ermB) cassette, which
enables the selection of the mutant organism
on selective media containing erythromycin (19).
Thereby, we identified a novel gene involved in
β-lactam resistance with a size of 705 bp. This
gene was designated as blrA since the product of
this gene shares an amino acid sequence similarity
of 41.33% with the protein BlrA (WP_041210465)
from Aeromonas jandaei. An S. aureus strain JE2
transposon mutant with the blrA gene disrupted
(JE2A) exhibited a reduced β-lactam resistance
when compared to wild type S. aureus strain
JE2 (unpublished data). Next, this mutation was
transferred from this mutant strain to S. aureus
strain MW2 (MW2A) using phage φ11-mediated
transduction. The transposon disruption of blrA
in MW2A was verified with the aid of a PCR
reaction (Fig. 1).
The transposon mutant MW2A was resistant to
β-lactam antibiotics
Our preliminary results using disc diffusion test
showed that MW2A is more susceptible to oxacillin
than MW2 (Fig. 2). Next, we performed the MICs
of the MW2 wild type and the blrA transposon
mutant MW2A to the β-lactam antibiotics listed
In Table 3. The blrA transposon mutant MW2A
exhibited a two-fold reduction for all β-lactam
antibiotics used in this study (Table 3).
Detection of PBP2a expression in the mutant
MW2A
Some auxiliary factors are crucial during cell wall
synthesis or may be involved in the regulation
Figure 1: Agarose gel electrophoresis analysis of PCR
products amplified from genomic DNA of MW2 and MW2A
using blrA-specific primers. M – 1 kb plus DNA Ladder; 1 –
PCR amplification of the wild-type gene blrA from MW2,
which has a size of 705 bp; 2 – absence of PCR amplification
due to transposon disruption of blrA in MW2A.
MW2 MW2A
Figure 2: Disc diffusion test using an oxacillin disc. The inhibition zones on the left and right have a diameter of 19 mm and
25 mm, respectively. This suggests that MW2A is more susceptible to oxacillin than MW2.
Table 3: MICs for MW2 and MW2A.
1 Values are means of three biological replicates.
MIC 1 (μg/mL)
Oxacillin Cefoxitin Cephradine Ceftazidime Cefaclor Imipenem
MW2 32 32 128 128 64 1
MW2A 16 16 64 64 32 0.5
of the activity of the gene mecA (20). Therefore,
we proposed that the mutation blrA may
somehow affect the expression of mecA or the
cell wall assembly. In order to prove this, PBP2a
agglutination latex test was performed. As shown
http://revistas.espoch.edu.ec/index.php/cssn
3. RESULTS
Previously, in our laboratory, the function of genes
required for β-lactam resistance was studied with
the aid of transposon mutagenesis, whereby a
transposon mutant library was constructed based
on S. aureus strain JE2 and mutants with reduced
oxacillin resistance were isolated from this library
(unpublished data). The transposon used for the
generation of the mutant library contains an
erythromycin resistance (ermB) cassette, which
enables the selection of the mutant organism
on selective media containing erythromycin (19).
Thereby, we identified a novel gene involved in
β-lactam resistance with a size of 705 bp. This
gene was designated as blrA since the product of
this gene shares an amino acid sequence similarity
of 41.33% with the protein BlrA (WP_041210465)
from Aeromonas jandaei. An S. aureus strain JE2
transposon mutant with the blrA gene disrupted
(JE2A) exhibited a reduced β-lactam resistance
when compared to wild type S. aureus strain
JE2 (unpublished data). Next, this mutation was
transferred from this mutant strain to S. aureus
strain MW2 (MW2A) using phage φ11-mediated
transduction. The transposon disruption of blrA
in MW2A was verified with the aid of a PCR
reaction (Fig. 1).
The transposon mutant MW2A was resistant to
β-lactam antibiotics
Our preliminary results using disc diffusion test
showed that MW2A is more susceptible to oxacillin
than MW2 (Fig. 2). Next, we performed the MICs
of the MW2 wild type and the blrA transposon
mutant MW2A to the β-lactam antibiotics listed
In Table 3. The blrA transposon mutant MW2A
exhibited a two-fold reduction for all β-lactam
antibiotics used in this study (Table 3).
Detection of PBP2a expression in the mutant
MW2A
Some auxiliary factors are crucial during cell wall
synthesis or may be involved in the regulation
Figure 1: Agarose gel electrophoresis analysis of PCR
products amplified from genomic DNA of MW2 and MW2A
using blrA-specific primers. M – 1 kb plus DNA Ladder; 1 –
PCR amplification of the wild-type gene blrA from MW2,
which has a size of 705 bp; 2 – absence of PCR amplification
due to transposon disruption of blrA in MW2A.
MW2 MW2A
Figure 2: Disc diffusion test using an oxacillin disc. The inhibition zones on the left and right have a diameter of 19 mm and
25 mm, respectively. This suggests that MW2A is more susceptible to oxacillin than MW2.
Table 3: MICs for MW2 and MW2A.
1 Values are means of three biological replicates.
MIC 1 (μg/mL)
Oxacillin Cefoxitin Cephradine Ceftazidime Cefaclor Imipenem
MW2 32 32 128 128 64 1
MW2A 16 16 64 64 32 0.5
of the activity of the gene mecA (20). Therefore,
we proposed that the mutation blrA may
somehow affect the expression of mecA or the
cell wall assembly. In order to prove this, PBP2a
agglutination latex test was performed. As shown
53
DISCOVERY OF THE NOVEL AUXILIARY FACTOR FOR -LACTAM RESISTANCE BLRA
IN COMMUNITY-ACQUIRED METHICILLIN-RESISTANT STAPHYLOCOCCUS AUREUSVolumen 14 Número 1 - 2 023
4. DISCUSSION
BlrA was previously described as a β-lactam
response regulator transcription factor in
Aeromonas hydrophila. This protein belongs to the
family of phosphorylation-dependent response
regulators and activates three β-lactamases
(23). Therefore, we proposed that BlrA is also
involved in β-lactam resistance in MRSA strains.
In this study, we observed that the mutation
of the novel gene blrA in S. aureus strain MW2
decreased the resistance of this organism to the
β-lactam antibiotics used in this study.
PBP2a is the most important protein involved
in β-lactam resistance because it participates
in the process of synthesis of the cell wall even
in the presence of β-lactam antibiotics (16). It is
known that some auxiliary factors may regulate
the activity of PBP2a. For instance, these factors
may exert a posttranscriptional effect on PBP2a,
probably, by mediating the export or folding
of this protein (24). In this study, we observed
positive agglutination in both MRSA MW2 wild
type and the mutant MW2A during the PBP2a
latex agglutination test. This suggests that the
mutation has no effect in the expression of the
gene mecA since the mutant also produces PBP2a.
Hence, the mechanism of action of the gene
blrA is, like most of auxiliary genes (25), mecA-
independent and this may confirm our previous
supposition that the product of the gene blrA is
crucial for the regulation of other genes required
for β-lactam resistance.
BlastP analysis reveals that BlrA shares a
42.17% identity with PhoB. The latter protein
Figure 3: PBP2a agglutination latex test; a: MW2; b: MW2A;
c: negative control. The figure shows agglutination for both
MW2 and MW2A, suggesting that both strains produce the
penicillin-binding protein PBP2A.
Figure 5: DeepTMHMM protein topology prediction of BlrA.
This figure shows that BlrA is a non-bound to membrane
protein, which is more likely located inside the cell.
Figure 4: Phage spot assay; a: MW2; b: MW2A. The figure
shows a clear spot on lawns produced by MW2 and MW2A,
demonstrating that phage is able to infect both strains.
a
a b
b c
in Fig. 3, agglutination was observed in both the
wild type S. aureus MW2 and the mutant MW2A.
Detection of possible structural changes in the
cell wall of the mutant MW2A
Considering also the possibility that BlrA may
be crucial for the regulation of the expression
of other genes that are involved in the synthesis
of specific components of the cell wall, including
WTAs, we decided to prove if the mutation in this
auxiliary gene affects the expression of genes
required for the synthesis of components of
WTAs. It is also known that WTAs serve as phage
receptor and, in consequence, any mutation in
auxiliary genes may prevent phage adsorption
(21). Therefore, phage spot assay was performed.
As shown in Fig. 4, plaques were observed in both
organisms.
Prediction of transmembrane helices in BlrA.
Since many auxiliary factors for β-lactam
resistance module the cell response to
antimicrobial stress either directly, if they
are membrane-bound, or indirectly, if they
are intracellular, we used the DeepTMHMM
(Transmembrane Helices; Hidden Markov Model)
software (22) to determine whether BlrA is
attached to membrane or not. As shown in Fig. 5,
BlrA is not attached to a membrane and is more
likely an intracellular protein.
DISCOVERY OF THE NOVEL AUXILIARY FACTOR FOR -LACTAM RESISTANCE BLRA
IN COMMUNITY-ACQUIRED METHICILLIN-RESISTANT STAPHYLOCOCCUS AUREUSVolumen 14 Número 1 - 2 023
4. DISCUSSION
BlrA was previously described as a β-lactam
response regulator transcription factor in
Aeromonas hydrophila. This protein belongs to the
family of phosphorylation-dependent response
regulators and activates three β-lactamases
(23). Therefore, we proposed that BlrA is also
involved in β-lactam resistance in MRSA strains.
In this study, we observed that the mutation
of the novel gene blrA in S. aureus strain MW2
decreased the resistance of this organism to the
β-lactam antibiotics used in this study.
PBP2a is the most important protein involved
in β-lactam resistance because it participates
in the process of synthesis of the cell wall even
in the presence of β-lactam antibiotics (16). It is
known that some auxiliary factors may regulate
the activity of PBP2a. For instance, these factors
may exert a posttranscriptional effect on PBP2a,
probably, by mediating the export or folding
of this protein (24). In this study, we observed
positive agglutination in both MRSA MW2 wild
type and the mutant MW2A during the PBP2a
latex agglutination test. This suggests that the
mutation has no effect in the expression of the
gene mecA since the mutant also produces PBP2a.
Hence, the mechanism of action of the gene
blrA is, like most of auxiliary genes (25), mecA-
independent and this may confirm our previous
supposition that the product of the gene blrA is
crucial for the regulation of other genes required
for β-lactam resistance.
BlastP analysis reveals that BlrA shares a
42.17% identity with PhoB. The latter protein
Figure 3: PBP2a agglutination latex test; a: MW2; b: MW2A;
c: negative control. The figure shows agglutination for both
MW2 and MW2A, suggesting that both strains produce the
penicillin-binding protein PBP2A.
Figure 5: DeepTMHMM protein topology prediction of BlrA.
This figure shows that BlrA is a non-bound to membrane
protein, which is more likely located inside the cell.
Figure 4: Phage spot assay; a: MW2; b: MW2A. The figure
shows a clear spot on lawns produced by MW2 and MW2A,
demonstrating that phage is able to infect both strains.
a
a b
b c
in Fig. 3, agglutination was observed in both the
wild type S. aureus MW2 and the mutant MW2A.
Detection of possible structural changes in the
cell wall of the mutant MW2A
Considering also the possibility that BlrA may
be crucial for the regulation of the expression
of other genes that are involved in the synthesis
of specific components of the cell wall, including
WTAs, we decided to prove if the mutation in this
auxiliary gene affects the expression of genes
required for the synthesis of components of
WTAs. It is also known that WTAs serve as phage
receptor and, in consequence, any mutation in
auxiliary genes may prevent phage adsorption
(21). Therefore, phage spot assay was performed.
As shown in Fig. 4, plaques were observed in both
organisms.
Prediction of transmembrane helices in BlrA.
Since many auxiliary factors for β-lactam
resistance module the cell response to
antimicrobial stress either directly, if they
are membrane-bound, or indirectly, if they
are intracellular, we used the DeepTMHMM
(Transmembrane Helices; Hidden Markov Model)
software (22) to determine whether BlrA is
attached to membrane or not. As shown in Fig. 5,
BlrA is not attached to a membrane and is more
likely an intracellular protein.
54Igor Eduardo Astudillo Skliarova
http://revistas.espoch.edu.ec/index.php/cssn
is an intracellular response regulator that
was previously linked to the regulation of
antimicrobial resistance (26). Following a
DeepTMHMM analysis (Fig. 5), we predicted that
BlrA is not bound to membrane similar to PhoB.
Therefore, BlrA in S. aureus is very likely to act as
an intracellular response regulator and regulates
genes involved in β-lactam resistance in response
to antimicrobial stress. Furthermore, we can
speculate that BlrA is part of an unknown regulon
like PhoB. Further studies will reveal which genes
are regulated by BlrA and the regulon that is
controlled by this protein.
There are some reports suggesting that
mutations in auxiliary genes may affect the
synthesis of components of the cell wall like, for
example, WTAs, which are the most abundant
components of the cell wall (21). In this study,
we observed absolutely no difference between
the wild type and the mutant in terms of phage
plaque formation, suggesting that the mutation
did not reduce the affinity of the phage φ68 to
the WTAs; therefore, the mutation does not
affect the structure or assembly of WTAs.
The increasing amount of antibiotic-resistant
strains is a concern for global health. It is
estimated that by 2050 ten million people
worldwide will die due to antibiotic resistance
(27). Understanding the mechanism of action of
auxiliary factors will provide a valuable tool to
combat the rise of antibiotic resistance. Currently,
alternative strategies, such as phage therapy and
combination of antibiotics, are being considered
in order to tackle antibiotic resistance (28, 29).
5. CONCLUSION
The present study demonstrates that the auxiliary
factor BlrA increases the resistance of the CA-
MRSA strain MW2 to β-lactam antibiotics. This
auxiliary factor does not affect the expression
of mecA and does not affect the structure of the
bacterial cell wall. However, it more likely acts
intracellularly and regulates the expression of
β-lactamases and thus increases resistance to
β-lactam antibiotics.
Future studies will be required to confirm the
function of BlrA. This involves the creation of a
clean blrA knock-out. Next, in order to verify if
the phenotype is due to the blrA mutation, it
is important to create a complement mutant.
This is usually performed using the plasmid
pRB474 as described in previous studies (30).
The complement mutant should exhibit a similar
phenotype as the wild-type strain. Additionally,
the protein BlrA can be expressed and purified to
study its specific activity.
The author declares no conflict of interest
The author takes complete responsibility for the
information presented in this original scientific
article.
The present Research Project was funded by
Secretaría Nacional de Educación Superior,
Ciencia, Tecnología e Innovación (SENESCYT) in
2016.
I would like to thank the University of Manchester
for providing the laboratories and facilitating the
purchase of materials and reagents required for
this research Project. Furthermore, I would like to
thank my former MSc supervisor Dr. Guoqing Xia
for providing feedback on the text, figures and
tables of this original scientific article. Additionally,
I would like to thank the Faculty of Public Health
(Facultad de Salud Pública) for allowing me to
share the knowledge about recently discovered
auxiliary factors present in community-acquired
methicillin-resistant Staphylococcus aureus.
6. CONFLICT OF INTEREST
7. LIMITATIONS OF LIABILITY
8. FUNDING
9. ACKNOWLEDGMENT
1. Sakr A, Brégeon F, Mège JL, Rolain JM, Blin O.
Staphylococcus aureus Nasal Colonization:
An Update on Mechanisms, Epidemiology,
Risk Factors, and Subsequent Infections.
Front Microbiol. 2018;9:2419.
2. Zhao N, Cheng D, Jian Y, Liu Y, Liu J, Huang
Q, et al. Molecular characteristics of
Staphylococcus aureus isolates colonizing
human nares and skin. Medicine in
Microecology. 2021;7:100031.
3. Ondusko DS, Nolt D. Staphylococcus aureus.
Pediatr Rev. 2018;39(6):287-98.
4. Cong Y, Yang S, Rao X. Vancomycin resistant
Staphylococcus aureus infections: A review
10. REFERENCES
http://revistas.espoch.edu.ec/index.php/cssn
is an intracellular response regulator that
was previously linked to the regulation of
antimicrobial resistance (26). Following a
DeepTMHMM analysis (Fig. 5), we predicted that
BlrA is not bound to membrane similar to PhoB.
Therefore, BlrA in S. aureus is very likely to act as
an intracellular response regulator and regulates
genes involved in β-lactam resistance in response
to antimicrobial stress. Furthermore, we can
speculate that BlrA is part of an unknown regulon
like PhoB. Further studies will reveal which genes
are regulated by BlrA and the regulon that is
controlled by this protein.
There are some reports suggesting that
mutations in auxiliary genes may affect the
synthesis of components of the cell wall like, for
example, WTAs, which are the most abundant
components of the cell wall (21). In this study,
we observed absolutely no difference between
the wild type and the mutant in terms of phage
plaque formation, suggesting that the mutation
did not reduce the affinity of the phage φ68 to
the WTAs; therefore, the mutation does not
affect the structure or assembly of WTAs.
The increasing amount of antibiotic-resistant
strains is a concern for global health. It is
estimated that by 2050 ten million people
worldwide will die due to antibiotic resistance
(27). Understanding the mechanism of action of
auxiliary factors will provide a valuable tool to
combat the rise of antibiotic resistance. Currently,
alternative strategies, such as phage therapy and
combination of antibiotics, are being considered
in order to tackle antibiotic resistance (28, 29).
5. CONCLUSION
The present study demonstrates that the auxiliary
factor BlrA increases the resistance of the CA-
MRSA strain MW2 to β-lactam antibiotics. This
auxiliary factor does not affect the expression
of mecA and does not affect the structure of the
bacterial cell wall. However, it more likely acts
intracellularly and regulates the expression of
β-lactamases and thus increases resistance to
β-lactam antibiotics.
Future studies will be required to confirm the
function of BlrA. This involves the creation of a
clean blrA knock-out. Next, in order to verify if
the phenotype is due to the blrA mutation, it
is important to create a complement mutant.
This is usually performed using the plasmid
pRB474 as described in previous studies (30).
The complement mutant should exhibit a similar
phenotype as the wild-type strain. Additionally,
the protein BlrA can be expressed and purified to
study its specific activity.
The author declares no conflict of interest
The author takes complete responsibility for the
information presented in this original scientific
article.
The present Research Project was funded by
Secretaría Nacional de Educación Superior,
Ciencia, Tecnología e Innovación (SENESCYT) in
2016.
I would like to thank the University of Manchester
for providing the laboratories and facilitating the
purchase of materials and reagents required for
this research Project. Furthermore, I would like to
thank my former MSc supervisor Dr. Guoqing Xia
for providing feedback on the text, figures and
tables of this original scientific article. Additionally,
I would like to thank the Faculty of Public Health
(Facultad de Salud Pública) for allowing me to
share the knowledge about recently discovered
auxiliary factors present in community-acquired
methicillin-resistant Staphylococcus aureus.
6. CONFLICT OF INTEREST
7. LIMITATIONS OF LIABILITY
8. FUNDING
9. ACKNOWLEDGMENT
1. Sakr A, Brégeon F, Mège JL, Rolain JM, Blin O.
Staphylococcus aureus Nasal Colonization:
An Update on Mechanisms, Epidemiology,
Risk Factors, and Subsequent Infections.
Front Microbiol. 2018;9:2419.
2. Zhao N, Cheng D, Jian Y, Liu Y, Liu J, Huang
Q, et al. Molecular characteristics of
Staphylococcus aureus isolates colonizing
human nares and skin. Medicine in
Microecology. 2021;7:100031.
3. Ondusko DS, Nolt D. Staphylococcus aureus.
Pediatr Rev. 2018;39(6):287-98.
4. Cong Y, Yang S, Rao X. Vancomycin resistant
Staphylococcus aureus infections: A review
10. REFERENCES
55
DISCOVERY OF THE NOVEL AUXILIARY FACTOR FOR -LACTAM RESISTANCE BLRA
IN COMMUNITY-ACQUIRED METHICILLIN-RESISTANT STAPHYLOCOCCUS AUREUSVolumen 14 Número 1 - 2 023
of case updating and clinical features. J Adv
Res. 2020;21:169-76.
5. Vermassen A, Leroy S, Talon R, Provot
C, Popowska M, Desvaux M. Cell Wall
Hydrolases in Bacteria: Insight on the
Diversity of Cell Wall Amidases, Glycosidases
and Peptidases Toward Peptidoglycan.
Frontiers in Microbiology. 2019;10.
6. Lowy FD. Staphylococcus aureus infections.
N Engl J Med. 1998;339(8):520-32.
7. De Rosa M, Verdino A, Soriente A, Marabotti
A. The Odd Couple(s): An Overview of
Beta-Lactam Antibiotics Bearing More
Than One Pharmacophoric Group.
International Journal of Molecular Sciences.
2021;22(2):617.
8. Zapun A, Contreras-Martel C, Vernet T.
Penicillin-binding proteins and β-lactam
resistance. FEMS Microbiology Reviews.
2008;32(2):361-85.
9. Fisher JF, Mobashery S. β-Lactam Resistance
Mechanisms: Gram-Positive Bacteria and
Mycobacterium tuberculosis. Cold Spring
Harb Perspect Med. 2016;6(5).
10. Panchal VV, Griffiths C, Mosaei H, Bilyk
B, Sutton JAF, Carnell OT, et al. Evolving
MRSA: High-level β-lactam resistance in
Staphylococcus aureus is associated with
RNA Polymerase alterations and fine
tuning of gene expression. PLoS Pathog.
2020;16(7):e1008672.
11. Lee AS, de Lencastre H, Garau J, Kluytmans
J, Malhotra-Kumar S, Peschel A, et al.
Methicillin-resistant Staphylococcus
aureus. Nature Reviews Disease Primers.
2018;4(1):18033.
12. Dittmann K, Schmidt T, Müller G, Cuny C,
Holtfreter S, Troitzsch D, et al. Susceptibility
of livestock-associated methicillin-resistant
Staphylococcus aureus (LA-MRSA) to
chlorhexidine digluconate, octenidine
dihydrochloride, polyhexanide, PVP-iodine
and triclosan in comparison to hospital-
acquired MRSA (HA-MRSA) and community-
aquired MRSA (CA-MRSA): a standardized
comparison. Antimicrob Resist Infect
Control. 2019;8:122.
13. Park MK, Nam DW, Byun JY, Hong SM, Bae
CH, Lee HY, et al. Differences in Antibiotic
Resistance of MRSA Infections in Patients
with Various Types of Otitis Media. J Int Adv
Otol. 2018;14(3):459-63.
14. Arêde P, Ministro J, Oliveira DC. Redefining
the role of the β-lactamase locus in
methicillin-resistant Staphylococcus aureus:
β-lactamase regulators disrupt the MecI-
mediated strong repression on mecA and
optimize the phenotypic expression of
resistance in strains with constitutive mecA
expression. Antimicrob Agents Chemother.
2013;57(7):3037-45.
15. Chen FJ, Wang CH, Chen CY, Hsu YC, Wang
KT. Role of the mecA gene in oxacillin
resistance in a Staphylococcus aureus clinical
strain with a pvl-positive ST59 genetic
background. Antimicrob Agents Chemother.
2014;58(2):1047-54.
16. Fergestad ME, Stamsås GA, Morales Angeles
D, Salehian Z, Wasteson Y, Kjos M. Penicillin-
binding protein PBP2a provides variable
levels of protection toward different
β-lactams in Staphylococcus aureus RN4220.
MicrobiologyOpen. 2020;9(8):e1057.
17. Uehara Y. Current Status of Staphylococcal
Cassette Chromosome mec (SCCmec).
Antibiotics. 2022;11(1):86.
18. Mikkelsen K, Sirisarn W, Alharbi O, Alharbi
M, Liu H, Nøhr-Meldgaard K, et al. The
Novel Membrane-Associated Auxiliary
Factors AuxA and AuxB Modulate
β-lactam Resistance in MRSA by stabilizing
Lipoteichoic Acids. International Journal of
Antimicrobial Agents. 2021;57(3):106283.
19. Fey PD, Endres JL, Yajjala VK, Widhelm TJ,
Boissy RJ, Bose JL, et al. A genetic resource
for rapid and comprehensive phenotype
screening of nonessential Staphylococcus
aureus genes. mBio. 2013;4(1):e00537-12.
20. Lade H, Kim JS. Bacterial Targets of Antibiotics
in Methicillin-Resistant Staphylococcus
aureus. Antibiotics (Basel). 2021;10(4).
21. Xia G, Wolz C. Phages of Staphylococcus
aureus and their impact on host evolution.
Infect Genet Evol. 2014;21:593-601.
22. Hallgren J, Tsirigos KD, Pedersen MD, Almagro
Armenteros JJ, Marcatili P, Nielsen H, et
al. DeepTMHMM predicts alpha and beta
transmembrane proteins using deep neural
networks. bioRxiv. 2022:2022.04.08.487609.
23. Avison MB, Niumsup P, Nurmahomed K,
Walsh TR, Bennett PM. Role of the ‘cre/
blr-tag’ DNA sequence in regulation
of gene expression by the Aeromonas
hydrophila β-lactamase regulator, BlrA.
Journal of Antimicrobial Chemotherapy.
2004;53(2):197-202.
24. Jousselin A, Manzano C, Biette A, Reed
P, Pinho MG, Rosato AE, et al. The
DISCOVERY OF THE NOVEL AUXILIARY FACTOR FOR -LACTAM RESISTANCE BLRA
IN COMMUNITY-ACQUIRED METHICILLIN-RESISTANT STAPHYLOCOCCUS AUREUSVolumen 14 Número 1 - 2 023
of case updating and clinical features. J Adv
Res. 2020;21:169-76.
5. Vermassen A, Leroy S, Talon R, Provot
C, Popowska M, Desvaux M. Cell Wall
Hydrolases in Bacteria: Insight on the
Diversity of Cell Wall Amidases, Glycosidases
and Peptidases Toward Peptidoglycan.
Frontiers in Microbiology. 2019;10.
6. Lowy FD. Staphylococcus aureus infections.
N Engl J Med. 1998;339(8):520-32.
7. De Rosa M, Verdino A, Soriente A, Marabotti
A. The Odd Couple(s): An Overview of
Beta-Lactam Antibiotics Bearing More
Than One Pharmacophoric Group.
International Journal of Molecular Sciences.
2021;22(2):617.
8. Zapun A, Contreras-Martel C, Vernet T.
Penicillin-binding proteins and β-lactam
resistance. FEMS Microbiology Reviews.
2008;32(2):361-85.
9. Fisher JF, Mobashery S. β-Lactam Resistance
Mechanisms: Gram-Positive Bacteria and
Mycobacterium tuberculosis. Cold Spring
Harb Perspect Med. 2016;6(5).
10. Panchal VV, Griffiths C, Mosaei H, Bilyk
B, Sutton JAF, Carnell OT, et al. Evolving
MRSA: High-level β-lactam resistance in
Staphylococcus aureus is associated with
RNA Polymerase alterations and fine
tuning of gene expression. PLoS Pathog.
2020;16(7):e1008672.
11. Lee AS, de Lencastre H, Garau J, Kluytmans
J, Malhotra-Kumar S, Peschel A, et al.
Methicillin-resistant Staphylococcus
aureus. Nature Reviews Disease Primers.
2018;4(1):18033.
12. Dittmann K, Schmidt T, Müller G, Cuny C,
Holtfreter S, Troitzsch D, et al. Susceptibility
of livestock-associated methicillin-resistant
Staphylococcus aureus (LA-MRSA) to
chlorhexidine digluconate, octenidine
dihydrochloride, polyhexanide, PVP-iodine
and triclosan in comparison to hospital-
acquired MRSA (HA-MRSA) and community-
aquired MRSA (CA-MRSA): a standardized
comparison. Antimicrob Resist Infect
Control. 2019;8:122.
13. Park MK, Nam DW, Byun JY, Hong SM, Bae
CH, Lee HY, et al. Differences in Antibiotic
Resistance of MRSA Infections in Patients
with Various Types of Otitis Media. J Int Adv
Otol. 2018;14(3):459-63.
14. Arêde P, Ministro J, Oliveira DC. Redefining
the role of the β-lactamase locus in
methicillin-resistant Staphylococcus aureus:
β-lactamase regulators disrupt the MecI-
mediated strong repression on mecA and
optimize the phenotypic expression of
resistance in strains with constitutive mecA
expression. Antimicrob Agents Chemother.
2013;57(7):3037-45.
15. Chen FJ, Wang CH, Chen CY, Hsu YC, Wang
KT. Role of the mecA gene in oxacillin
resistance in a Staphylococcus aureus clinical
strain with a pvl-positive ST59 genetic
background. Antimicrob Agents Chemother.
2014;58(2):1047-54.
16. Fergestad ME, Stamsås GA, Morales Angeles
D, Salehian Z, Wasteson Y, Kjos M. Penicillin-
binding protein PBP2a provides variable
levels of protection toward different
β-lactams in Staphylococcus aureus RN4220.
MicrobiologyOpen. 2020;9(8):e1057.
17. Uehara Y. Current Status of Staphylococcal
Cassette Chromosome mec (SCCmec).
Antibiotics. 2022;11(1):86.
18. Mikkelsen K, Sirisarn W, Alharbi O, Alharbi
M, Liu H, Nøhr-Meldgaard K, et al. The
Novel Membrane-Associated Auxiliary
Factors AuxA and AuxB Modulate
β-lactam Resistance in MRSA by stabilizing
Lipoteichoic Acids. International Journal of
Antimicrobial Agents. 2021;57(3):106283.
19. Fey PD, Endres JL, Yajjala VK, Widhelm TJ,
Boissy RJ, Bose JL, et al. A genetic resource
for rapid and comprehensive phenotype
screening of nonessential Staphylococcus
aureus genes. mBio. 2013;4(1):e00537-12.
20. Lade H, Kim JS. Bacterial Targets of Antibiotics
in Methicillin-Resistant Staphylococcus
aureus. Antibiotics (Basel). 2021;10(4).
21. Xia G, Wolz C. Phages of Staphylococcus
aureus and their impact on host evolution.
Infect Genet Evol. 2014;21:593-601.
22. Hallgren J, Tsirigos KD, Pedersen MD, Almagro
Armenteros JJ, Marcatili P, Nielsen H, et
al. DeepTMHMM predicts alpha and beta
transmembrane proteins using deep neural
networks. bioRxiv. 2022:2022.04.08.487609.
23. Avison MB, Niumsup P, Nurmahomed K,
Walsh TR, Bennett PM. Role of the ‘cre/
blr-tag’ DNA sequence in regulation
of gene expression by the Aeromonas
hydrophila β-lactamase regulator, BlrA.
Journal of Antimicrobial Chemotherapy.
2004;53(2):197-202.
24. Jousselin A, Manzano C, Biette A, Reed
P, Pinho MG, Rosato AE, et al. The
56Igor Eduardo Astudillo Skliarova
http://revistas.espoch.edu.ec/index.php/cssn
Staphylococcus aureus Chaperone PrsA
Is a New Auxiliary Factor of Oxacillin
Resistance Affecting Penicillin-Binding
Protein 2A. Antimicrob Agents Chemother.
2015;60(3):1656-66.
25. Miragaia M. Factors Contributing to the
Evolution of mecA-Mediated β-lactam
Resistance in Staphylococci: Update and New
Insights From Whole Genome Sequencing
(WGS). Front Microbiol. 2018;9:2723.
26. Bhagirath AY, Li Y, Patidar R, Yerex K, Ma X,
Kumar A, et al. Two Component Regulatory
Systems and Antibiotic Resistance in
Gram-Negative Pathogens. Int J Mol Sci.
2019;20(7).
27. Global burden of bacterial antimicrobial
resistance in 2019: a systematic analysis.
Lancet. 2022;399(10325):629-55.
28. Łusiak-Szelachowska M, Międzybrodzki
R, Drulis-Kawa Z, Cater K, Knežević P,
Winogradow C, et al. Bacteriophages and
antibiotic interactions in clinical practice:
what we have learned so far. Journal of
Biomedical Science. 2022;29(1):23.
29. Angst DC, Tepekule B, Sun L, Bogos B,
Bonhoeffer S. Comparing treatment
strategies to reduce antibiotic resistance in
an in vitro epidemiological setting. Proc Natl
Acad Sci U S A. 2021;118(13).
30. Slavetinsky CJ, Hauser JN, Gekeler C,
Slavetinsky J, Geyer A, Kraus A, et al.
Sensitizing Staphylococcus aureus to
antibacterial agents by decoding and
blocking the lipid flippase MprF. Elife.
2022;11.
http://revistas.espoch.edu.ec/index.php/cssn
Staphylococcus aureus Chaperone PrsA
Is a New Auxiliary Factor of Oxacillin
Resistance Affecting Penicillin-Binding
Protein 2A. Antimicrob Agents Chemother.
2015;60(3):1656-66.
25. Miragaia M. Factors Contributing to the
Evolution of mecA-Mediated β-lactam
Resistance in Staphylococci: Update and New
Insights From Whole Genome Sequencing
(WGS). Front Microbiol. 2018;9:2723.
26. Bhagirath AY, Li Y, Patidar R, Yerex K, Ma X,
Kumar A, et al. Two Component Regulatory
Systems and Antibiotic Resistance in
Gram-Negative Pathogens. Int J Mol Sci.
2019;20(7).
27. Global burden of bacterial antimicrobial
resistance in 2019: a systematic analysis.
Lancet. 2022;399(10325):629-55.
28. Łusiak-Szelachowska M, Międzybrodzki
R, Drulis-Kawa Z, Cater K, Knežević P,
Winogradow C, et al. Bacteriophages and
antibiotic interactions in clinical practice:
what we have learned so far. Journal of
Biomedical Science. 2022;29(1):23.
29. Angst DC, Tepekule B, Sun L, Bogos B,
Bonhoeffer S. Comparing treatment
strategies to reduce antibiotic resistance in
an in vitro epidemiological setting. Proc Natl
Acad Sci U S A. 2021;118(13).
30. Slavetinsky CJ, Hauser JN, Gekeler C,
Slavetinsky J, Geyer A, Kraus A, et al.
Sensitizing Staphylococcus aureus to
antibacterial agents by decoding and
blocking the lipid flippase MprF. Elife.
2022;11.